Live Ca Import data of Vietnam imports from united-states-of-america via port Data Gia-thuy-headquarters, our Vietnam customs import data reports include date, value, quantity, product description, HS code, port, country, and Vietnam ca importers data
| Date |
HS Code |
Product Description |
Origin Country |
Custom Name |
QTY. |
Unit |
Value($) |
Importer Name |
|---|---|---|---|---|---|---|---|---|
| 2024-04-19 00:00:00 |
38229090
|
Reagent for laboratory use, manufacturer: IDT, 100 nmole DNA Oligos, ATAAGGGAAGTCGGCAAAATAGATCCGTAA, 0.1 ml / vial, Product Name: CA-INT-L, 100% new product | United States of America | Gia Thuy Headquarters | 1 | UNA | 9.23 | Importer Name |
| 2024-04-19 00:00:00 |
38229090
|
Reagent for laboratory use, manufacturer: IDT, 100 nmole DNA Oligos, CCTTGGCTGTGGTTTCGCTAGATAGTAGAT, 0.1 ml / vial, Product Name: CA-INT-R, 100% new product | United States of America | Gia Thuy Headquarters | 1 | UNA | 9.23 | Importer Name |
| 2024-04-04 00:00:00 |
38229090
|
Reagent for laboratory use, manufacturer: IDT, 100 nm PrimeTime, FAM / TGA GAC TGA GCG GGA CA / MGB-NFQ, 0.1 ml / vial, Product Name: Doan: IHNvN 818 MGB, 100% new product | United States of America | Gia Thuy Headquarters | 1 | UNA | 251.54 | Importer Name |
| 2024-04-08 00:00:00 |
38229090
|
Reagents for laboratory use, manufacturer: IDT, 0.5 nm PrimeTime, 5HEX/CA CTG +CTA +A+C+G GGA /3IABkFQ, 0.1 ml / vial, Product Name: 2182-WT, 100% new product | United States of America | Gia Thuy Headquarters | 1 | UNA | 114.67 | Importer Name |
| 2024-04-15 00:00:00 |
32089019
|
Exterior paint resistant to heat above 100 degrees (Goods used for aircraft in subgroup 9820) PN: VSTT-P-1757BA. New 100%. COC number: 46821738. 11.5 OZ/CA. Production: August 2023. Expiry date: August 2026 | United States of America | Gia Thuy Headquarters | 2 | UNL | 80 | Importer Name |
| 2024-04-16 00:00:00 |
32089019
|
Aircraft coatings resistant to heat above 100 degrees (Goods used for aircraft in subgroup 9820) PN: MIL-PRF-23377TT. 100% new product, COC number: 312365. 0.75GL/CA. Manufacturer: March 28, 2024. Expiry date: March 28, 2026 | United States of America | Gia Thuy Headquarters | 1 | UNL | 425 | Importer Name |
2024-04-19 00:00:00
Reagent for laboratory use, manufacturer: IDT, 100 nmole DNA Oligos, ATAAGGGAAGTCGGCAAAATAGATCCGTAA, 0.1 ml / vial, Product Name: CA-INT-L, 100% new product
1
UNA
9.23
2024-04-19 00:00:00
Reagent for laboratory use, manufacturer: IDT, 100 nmole DNA Oligos, CCTTGGCTGTGGTTTCGCTAGATAGTAGAT, 0.1 ml / vial, Product Name: CA-INT-R, 100% new product
1
UNA
9.23
2024-04-04 00:00:00
Reagent for laboratory use, manufacturer: IDT, 100 nm PrimeTime, FAM / TGA GAC TGA GCG GGA CA / MGB-NFQ, 0.1 ml / vial, Product Name: Doan: IHNvN 818 MGB, 100% new product
1
UNA
251.54
2024-04-08 00:00:00
Reagents for laboratory use, manufacturer: IDT, 0.5 nm PrimeTime, 5HEX/CA CTG +CTA +A+C+G GGA /3IABkFQ, 0.1 ml / vial, Product Name: 2182-WT, 100% new product
1
UNA
114.67
2024-04-15 00:00:00
Exterior paint resistant to heat above 100 degrees (Goods used for aircraft in subgroup 9820) PN: VSTT-P-1757BA. New 100%. COC number: 46821738. 11.5 OZ/CA. Production: August 2023. Expiry date: August 2026
2
UNL
80
2024-04-16 00:00:00
Aircraft coatings resistant to heat above 100 degrees (Goods used for aircraft in subgroup 9820) PN: MIL-PRF-23377TT. 100% new product, COC number: 312365. 0.75GL/CA. Manufacturer: March 28, 2024. Expiry date: March 28, 2026
1
UNL
425
Vietnam ca import data for imports from united-states-of-america via Port Gia-thuy-headquarters provides detailed shipment records, including product specifications, HS codes, quantities, values, importer-exporter names, origin & destination country, and port-level insights.
Vietnam ca import data for imports from united-states-of-america via Port Gia-thuy-headquarters helps businesses analyze demand trends, track competitor activity, identify active importers, and evaluate pricing patterns. It also supports sourcing strategies, partnership opportunities, and market entry planning by providing detailed insights into trade flows and buyer behavior.
Companies can analyze demand trends, identify key buyers, monitor competitor activity, and evaluate pricing strategies to make informed business decisions.
This port functions as a processing and customs handling point where imported goods, including ca, are recorded, cleared, and distributed into Vietnam’s supply chain.
Yes, the database includes importer & exporter details, enabling exporters and suppliers to connect with verified buyers and expand their business network in Vietnam.
